تعبير الخبر الوراثي

من خلال دراسة تجارب GRIFFITH تبين أن نقل ADNs إلى المكورات R اكتسبت هذه الأخيرة صفة المحفظة.

إذا هناك علاقة بين الخبر الوراثي والصفة.

الصفة هنا هي وجود أو غياب المحفظة، وهي ميزة تميز إحدى البكتيريات عن الأخرى.

هذا يعني أن الصفات هي ميزات نوعية أو كمية تميز فردا عن باقي أفراد نوعه. فبعضها يرى بالعين المجردة(لون الأزهار مثلا) وأخرى تظهر بواسطة اختبارات خاصة(الفصيلة الدموية مثلا)

 

تساؤل:

       ـ  كيف يتحكم الخبر الوراثي في الصفات؟

  1  معطيات تجريبية:

نقوم بزرع بكتيرية  Escherichia Coli في وسط زرع ملائم(غراء+ كليكوز+ فيتامينات+أحماض أمينية في حرارة 37C)، ثم يتم تعريض الوسط لأشعة فوق بنفسجية UV. بعد تشكل لمات بكتيرية يتم نقلها إلى وسطين: أحدهما يحتوي على Streptomycine الذي يعتبر مضادا حيويا، والأخر بدون ستربتوميسين. تمثل الوثيقة الموالية، الظروف والنتائج المحصل عليها.

1ـ  قارن نتائج الزرع في الوسطين.

2 ـ اقترح تفسيرا للنتائج المحصل عليها.

1 ـ في غياب الستربتوميسين تتشكل مستعمرات بكتيرية على شكل لمات على سطح الوسط. لكن عند زرعها في وسط يحتوي على المضاد الحيوي، فإننا نحصل على بعض اللمات فقط على شكل كتل صغيرة مبعثرة على سطح الوسط.

2 ـ  البكتيريات التي ماتت بوجود  Streptomycine  تعتبر حساسة لهذا المضاد الحيوي ويرمز إليها بـ StrepS أما التي بقيت حية تعتبر مقاومة ويرمز إليها بـ StrepR . ظهور هذه الصفة الجديدة التي انتقلت إلى الأجيال الموالية أثناء تكاثر البكتيريات تعتبر وراثية أي أن التغيير حدث على مستوى المادة الوراثية ADN 

 2- مفاهيم الطفرة والمورثة والحليل:

 ـ الطفرة mutation هي تغير وراثي وفجائي في انتقال المادة الوراثية على جزء من ADN الذي يحمل الخبر الوراثي المتعلق بصفة معينة.

   – يمكن أن تكون الطفرة تلقائية أو محدثة بعوامل فيزيائية(أشعة) أو كيميائية(مواد كيميائية) أو بيولوجية(فيروسية)، هناك  أنواع عديدة من الطفرات:

        ـ طفرة عن طريق إضافة أو ضياع نيكليوتيد. انظر الرابط

        ـ طفرة عن طريق استبدال نيكليوتيد بنيكليوتيد آخر. انظر الرابط

        ـ طفرة عن طريق تغير ترتيب النيكليوتيدات…

  أمثلة لبعض الطفرات: انظر الرابط

 – جزء الـ ADN الذي يحمل الخبر الوراثي المتعلق بصفة معينة يشكل ما يسمى بالمورثة gene. كل مورثة توجد بنسخة واحدة على صبغي معين،ويمكنها أن توجد على عدة أشكال تسمى الحليلات alleles .

 مثلا StrepR وStrepS حليلين لنفس المورثة (العلاقة مع المضاد الحيوي Streptomycine  فالحليل StrepS متوحش (الأصل) والحليل StrepR طافر.

3- العلاقة صفة ـ بروتين:

تمثل الأمثلة التالية مقارنة بين الأفراد الطافرة والأفراد المتوحشة:

المثال الأول: تبين الوثيقة1 سلالتين من الأرانب: سلالة متوحشة سوداء وسلالة طافرة ذات لون أمهق

أرنب أمهق
أرنب أسود

يرجع اللون الأسود للأرانب إلى صبغة الميلانين الموجودة في الزغب. يتم تركيب هذه الصبغة في عدة مراحل انطلاقا من الحمض الأميني التيروزين، ويتدخل في هذا التركيب عدة أنزيمات من بينها أنزيم التيروزيناز الضروري لتحول التيروزين إلى مركب Dopa . تبين الوثيقة 2 أصل اللون الأسود عند الأرانب.

1ـ  باستغلالك لمعطيات الوثيقتين 1 و2، أبرز العلاقة صفة بروتين.

1 ـ يعود اللون الأسود إلى صبغة الميلانين التي تتطلب أنزيم التيروزيناز(بروتين) الذي يمكن من تحويل التيروزين إلى دوبا. في حالة عدم فعالية هذا الأنزيم تظهر صفة المهق، إذن صفة اللون عند الأرانب مرتبطة بنشاط بروتين(أنزيم). وهذا يدل على وجود علاقة بين البروتين والصفة.

المثال الثاني: الخضاب الدموي بروتين يوجد داخل الكريات الحمراء وله دورين، وظيفي يتجلى في نقل الغازات التنفسية وبنيوي يتجلى في إعطاء الشكل الكروي المقعر للكريات الحمراء.ينتج فقر الدم المنجلي عن تركيب خضاب دموي Hemoglobine غير عادي (تشوه الكريات الحمراء تصبح منجلية الشكل) ويرمز له بـ HbS عوض HbA.  

كريات حمراء منجلية الشكل

http://www2.lifl.fr/~touzet/M1/tp2.html

تبين الوثيقة التالية مقارنة بين جزء من الخضاب HbA والخضاب HbS وبين جزء من المورثة HbS وجزء من المورثة HbA.

1ـ  اعنمادا على مقارنة كل من الخضاب العادي وغير العادي، استنتج العلاقة بين االبروتين والصفة.

2 ـ انطلاقا من مقارنة كل من جزء مورثة HbA و HbS ، استنتج العلاقة بين المورثة والبروتين.

1 ـ مقارنة:  لا تختلف جزيئة HbS عن HbA إلا باستبدال الحمض الأميني 6 رقم GLU بـ VAL.

إذن هناك علاقة بين الصفة والبروتين، فشكل الكريات الحمراء(الصفة) مرتبط بطبيعة الخضاب الدموي(البروتين).

 2 ـ  مقارنة: هناك تشابه في جميع القواعد الأزوتية باستثناء القاعدة T رقم 17 في ADN المتحكم في تركيب HbA و التي عوضت بالقاعدة A في ADN المتحكم في تركيب HbS.

 إذن حدثت طفرة تجلت في استبدال T بـ A على مستوى المورثة أدت إلى استبدال الحمض الأميني GLU بـ VAL على مستوى البروتين وبالتالي تحول HbA إلى HbS الذي أدى إلى تغير شكل الكريات الحمراء(الصفة)

إذن هناك علاقة بين المورثة والبروتين: ترتيب النيكليوتيدات في ADN هو الذي يحدد طبيعة وترتيب الأحماض الأمينية في البروتين.

يتم تركيب البروتينات على مستوى السيتوبلاسم تحت إشراف المورثات(ADN) الموجودة في النواة فكيف تصل الإشارات من النواة إلى السيتوبلاسم لتركيب البروتينات؟

4 – انتقال الإشارات من النواة إلى السيتوبلاسم لتركيب البروتينات.

            أ ـ معطيات تجريبية:

لمعرفة كيف تنتقل الإشارات من ADN إلى السيتوبلاسم، نقترح المعطيات التجريبية التالية:

نقوم بعزل المكونات الخلوية والجزيئية المختلفة من خلايا تنتج الخضاب الدموي ( البروتين) ونحقنها في خلايا غير قادرة على إنتاج الخضاب الدموي، النتائج المحصل عليها ممثلة في الجدول التالي:

1ـ  اعنمادا على المعطيات التجريبية استنتج المكون المسؤول عن انتقال الاشارات من النواة إلى السيتوبلاسم لتركيب البروتين.

1 ـ نلاحظ أن الخلايا غير القادرة على انتاج الخضاب الدموي تستطيع إنتاجه فقط عند حقنها بـ ARNm ، وبالتالي فإن ARNm هو صلة الوصل بين الخبر الوراثي الموجود في النواة والسيتوبلاسم حيث تركب البروتينات.

    ب ـ بنية و مكونات ARN:

تبين الوثيقة1 تمثيلا تخطيطيا لجزء من ARN ، بينما تمثل الوثيقة2 مقارنة بين جزيئتي ADN وARN.

الوثيقة 1

الوثيقة 2

ARNm                                                    ADN

1 ـ انطلاقا من الوثيقة1 ، استخرج مكونات ARN.

2 ـ اعتمادا على الوثيقة2، قارن جزيئتي ADN وARN .

1 ـ يتكون ARN من متتالية من النيكليوتيدات وكل نيكليوتيد يتكون من:

– حمض فوسفوري H3PO4

سكر ريبوزي   C5H10O5

– قواعد أزوتيةA: أدنين، وG: كوانين، وC: سيتوزين و أوراسيل.

2 ـ مقارنة ARN و ADN

كل من الجزيئتين عبارة عن عديد نيكليوتيدات، لكن هناك اختلافات عديدة نوردها في الجدول التالي

ADN                                                    ARN

لولب واحد                                    لولب مضاعف

السكر ريبوز                                 السكر ريبوز ناقص اكسجين

القواعد الأزوتية ACGU                  القواعد الازوتية ACGT

كتلة صغيرة                                 كتلة كبيرة

     ج ـ علاقة ADN بــ ARN:

تظهر الوثيقة التالية صورة لملاحظة مجهرية لجزء من ADN حيث يلاحظ و جود أجزاء من ARN ملتصقة به. و تدل الملاحظة على وجود علاقة بين ADN و ARN .

fr.wikipedia.org

تبين الوثيقة التالية كيفية انتقال الطابع الوراثي من ADN إلى ARN أي النسخ الوراثي Transcription حيث ينتقل الخبر الناتج عن نسخ المورثة إلى السيتوبلاسم على شكل رسول يسمى ARNm

fr.wikipedia.org

يظهر الشريط التالي آلية النسخ الوراثي.

1 ـ باستنادك على الوثيقتين، بين كيف يتم النسخ الوراثي.

1 ـ يعمل أنزيم ARN بوليمراز على تفريق لولبي ADN في مقدمة المورثة المراد نسخها، ثم يشرف على إدماج النيكليوتيدات الحرة حسب تكامل القواعد الأزوتية، وعندما يصل إلى نهاية المورثة يتم تحرير ARN بوليمراز و ARNm.

 ملحوظة: تنتقل عدة جزيئات الأنزيم من موقع بداية الاستنساخ إلى نهايته وهكذا يتم نسخ عدة جزيئات ARNm في آن واحد.

 5 ـ  علاقة ARNm  بتركيب البروتينات:

   نحضر خلاصة بكتيريات تحتوي على كل المكونات السيتوبلاسمية لكن ينعدم فيها ADN و ARN ، بعد ذلك تضاف إليها أحماض أمينية وARN ذائب مستخلص من السيتوبلاسم. 

يمثل المبيان التالي النتائج المحصل:

   1ـ اعتمادا على تحليل الوثيقة، استنتج العلاقة بين ARN والأحماض الأمينية.

1 ـ  يتبين أن بعد كل حقن لـ ARN يرتفع عدد الأحماض الأمينية المدمجة في البروتينات، بالتالي فان  ARN هو المسؤول عن دمج الأحماض الأمينية في البروتينات.

        6 ـ  تركيب البروتينات:

                  6 ـ 1 ـ تجربة  1961 Nirenberg and Matthaei

      1ـ ماذا تستنتج انطلاقا من تحليل نتيجة التجربة؟

1 ـ  نلاحظ أنه عند حقن ARNm يحتوي على متتالية من النيكليوتيد U فقط يتم تركيب بيبتيد يتكون من تسلسل من نفس الحمض الأميني Phe ، ويوحي هذا بوجود علاقة بين تسلسل النيكليوتيدات وتسلسل الاحماض الامينية.

                  6 ـ 2 ـ تجارب أخرى حسب نموذج   Nirenberg and Matthaei

1ـ ماذا تستنتج انطلاقا من تحليل نتائج التجربة؟

1 ـ نحصل على بروتين يتكون من تسلسل نفس الحمض الأميني فقط عند استخدام ARNm يتكون من تسلسل نفس النبكليوتيد أو تسلسل نفس الثلاثية النبكليوتيدية. وبما أن ARNm يتكون من أربعة نيكليوتيدات بينما تتكون البروتينات من 20 نوعًا من الأحماض الأمينية المختلفة. لذلك من المستحيل أن يرمز نيكليوتيد واحد لحمض أميني واحد. لذا فإن ترجمة ARNm تتم بواسطة ثلاثية نيكليوتيدية، تسمى الوحدة الرمزية.

بما أن عدد النيكليوتيدات هو 4، فعدد التوافقات الممكنة للإشارة إلى 20 حمض أميني طبيعي هو 43= 64 وهذا يعني أن عدة وحدات رمزية ترمز لحمض أميني واحد وبعضها لا يشير لأي حمض أميني( نقول أنها بدون معنى). تكون لائحة الوحدات الرمزية والأحماض الأمينية المناسبة  له الرمز الوراثي Le code génétique

جدول الرمز الوراثي

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/code.gif

     6 ـ 3 ـ آلية تركيب البروتينات:

لتعرف آلية تركيب البروتينات نقترح المعطيات التالية:

 توضح الوثائق 1 و2 و3 ، المراحل الثلاث الأساسية لتركيب البروتينات.

بينما يمثل الشريط الاتي متحركة لنفس المراحال.

الروابط: الرابط1 والرابط2 و الرابط3

1ـ اعتمادا على الوثائق 1 و2 و3 والشريط، صف مراحل تركيب البروتينات.

2 ـ استخلص العناصر الضرورية لتركيب البروتينات.

1 ـ يتم تركيب البروتينات عبر ثلاث مراحل أساسية:

 أ ـ المرحلة الأولى: البداية

    – تثبيت الوحدة الريبوزومية الصغرى على ARNm الذي تكون وحدته الرمزية الأولى AUG .

    – وصول ARNt حاملا معه حمض أميني Met .

    – تثبيت الوحدة الريبوزومية الكبرى وبداية عمل الريبوزوم.

ب ـ المرحلة الثانية: الاستطالة

   –  وصول ARNt آخر حاملا معه حمض أميني  مطابق للوحدة الرمزية الموالية .

   – تشكل رابطة بيبتيدية بين Met والحمض الأميني الموالي وانشطار الرابطة بين Met و ARNt الذي يغادر الريبوزوم (وجود طاقة ATP )

   – يتحرك الريبوزوم بوحدة رمزية واحدة و هكذا تتضاعف الأحماض الأمينية في السلسلة البيبتيدية.

ج ـ المرحلة الثالثة: النهاية

     – عندما يصل الريبوزوم إلى الوحدة الرمزية(UAA أو UAG أو UGA ) وهي بدون معنى أي أنها لا تشير إلى أي حمض أميني يتوقف تركيب البروتين وتسمى بذلك وحدات قف.

     –  تفترق وحدتي الريبوزوم عن بعضهما البعض وعن ARNm ويتم تحرير السلسلة البيبتيدية.

     –  ينفصل الحمض الأميني Met عن باقي السلسلة البيبتيدية.

2 ـ  يحتاج تركيب البروتينات بالاضافة الى المورثة وARNm الى:

    ـ  ريبوزومات وهي بنيات خلوية صغيرة يتشكل كل واحد منها من وحدة صغيرة ووحدة كبيرة، وتتكون كل وحدة من ARN ريبوزومي (ARNr) ومن بروتينات سيتوبلاسمية.

    ـ  ARN ناقل (ARNt) الموجود بالسيتوبلاسم، ويختص بنقل الأحماض الأمينية الحرة حسب طبيعة مضاد الوحدة الرمزية الموجود أسفل ARNt.

    ـ أحماض أمينية وهي 20 حمض أميني طبيعي.

    ـ عوامل منشطة.

    ـ طاقة لمختلف مراحل التركيب، مصدرها الاستقلاب الطاقي

ملحوظة: تتم ترجمة جزيئة ARNm عدة مرات من طرف مجموعة من الريبوزومات لكن بتأخير زمني وهذا ما يفسر تركيب عدة جزيئات من نفس البروتين. انظر الرابط

 تمرين:

 لنعتبر جزء من الخييط غير المستنسخ لـ ADN مورثة.

ATGCCCTGTGCCATCAAGTAA

1ـ اعط متتالية الأحماض الأمينية المطابقة للبروتين الذي تتحكم في تركيبه هذه المورثة.

2ـ حدد نتيجة استبدال النيكليوتيد C رقم 10 من اللولب المستنسخ بالنيكليوتيد A.

الإجابة